Category Archives: Python

Error loading bedtools/2.22.0

By default, gcc/4.4 is loaded in my cluster environment. This happened when running bedtools: gcc/4.7.0(5):ERROR:150: Module ‘gcc/4.7.0’ conflicts with the currently loaded module(s) ‘gcc/4.4’ gcc/4.7.0(5):ERROR:102: Tcl command execution failed: conflict gcc/4.4 bedtools/2.22.0(6):ERROR:151: Module ‘bedtools/2.22.0’ depends on one of the module(s) … Continue reading

Posted in bash, Bioinformatics, Python | Leave a comment

Genomics Workshop (Week 2, Day 4) – QIIME and Metgenomics Analyses

Daniel McDonald from Dr. Rob Knight’s lab, U. Colorado Some links: http://www.earthmicrobiome.org/ http://www.hmpdacc.org/ QIIME analysis tool, using iPython notebook: http://evomics.org/learning/genomics/metagenomics/metagenomics-laboratories/ Data files: http://qiime.org/home_static/dataFiles.html from this study: http://www.ncbi.nlm.nih.gov/pubmed/21624126 additional info: http://www.ncbi.nlm.nih.gov/pubmed/20534432 argument for using iPython notebook: http://www.ncbi.nlm.nih.gov/pubmed/23096404 iPython notebook: http://ipython.org/ipython-doc/stable/interactive/notebook.html

Posted in Bioinformatics, Data Analyses, Python | Leave a comment

PYTHONPATH

To run graphing graphics in Python: flcellogrl@flcellogrl:~$ pip install matplotlib Installing Python modules with virtualenv or pip: http://www.bdnyc.org/2012/09/17/editing-pythonpath-to-import-modules/ Logical and neat directory structure will make your own, your computer’s and your collaborators’ lives much easier. My recommendation: Create a master … Continue reading

Posted in Genomics Workshop, Python | Leave a comment

Python is cool.

Some Python links: http://pycogent.org/ http://nbviewer.ipython.org/ http://nbviewer.ipython.org/github/CamDavidsonPilon/Probabilistic-Programming-and-Bayesian-Methods-for-Hackers/blob/master/Chapter1_Introduction/Chapter1_Introduction.ipynb https://github.com/ipython/ipython/wiki/A-gallery-of-interesting-IPython-Notebooks

Posted in Links, Python, software | Leave a comment

Finding coding sequences in DNA

From the UCSD “Bioinformatics Algorithms” class, programming assignments week 2. Given a DNA sequence and an amino acid peptide sequence: DNA=”ATGGCCATGGCCCCCAGAACTGAGATCAATAGTACCCGTATTAACGGGTGA” aapeptide=”MA” I want to find all occurrences (including reverse compliment) of the coding sequence in the DNA for that … Continue reading

Posted in Python | Leave a comment