Archives
- November 2018 (1)
- February 2018 (1)
- March 2017 (1)
- February 2017 (1)
- September 2016 (1)
- August 2016 (1)
- July 2016 (1)
- April 2016 (1)
- March 2016 (1)
- February 2016 (2)
- January 2016 (3)
- November 2015 (3)
- October 2015 (4)
- September 2015 (5)
- August 2015 (11)
- July 2015 (1)
- April 2015 (2)
- March 2015 (4)
- February 2015 (1)
- July 2014 (3)
- January 2014 (16)
- December 2013 (3)
- November 2013 (9)
- October 2013 (22)
- September 2013 (19)
- July 2013 (1)
- June 2013 (3)
- May 2013 (7)
- April 2013 (5)
- January 2013 (1)
- August 2012 (1)
- July 2012 (1)
Category Archives: Linux
Downloading masses of files, useful ftp commands
You have finished a sequencing project and now your sequencing facility is sending you lots of files! You’re eager to see your results. Your facility sends you a link with files displayed on a website. Now what are you supposed … Continue reading
Posted in Linux
Leave a comment
How to install linux software without root privileges
HPC cluster users rarely have root privileges for installing new software. Default location for installation is usually /usr/bin/, but our user directories are usually located somewhere else like /home/ljcohen/ or /mnt/home/ljcohen/. So, what are you supposed to do when you … Continue reading
Posted in cluster, High Performance Computing, Linux, software
2 Comments
iPlant – Advanced workshop
“API for scalable science” – Matt Vaughn, John Fonner https://pods.iplantcollaborative.org/wiki/display/Events/2015+09+21+iPlant+Workshops+at+UC+Davis https://github.com/iPlantCollaborativeOpenSource/Advanced_iPlant slides: https://docs.google.com/presentation/d/1RioNnjvL2qyRPQHSQ2-MG04m_LwNzf9gGqHwsSpCguM/edit?usp=sharing Install Docker (I’m running OSX. See other instructions for Linux and Windows, although there were challenges with Windows users in the workshop). Docker is solution to binaries and configurations, etc. specific … Continue reading
Posted in Linux, workshops
Leave a comment
NGS 2015 Week 3 – Docker Tutorial
Here at MSU’s W.K. Kellogg Biological Station for the 3rd week of NGS 2015 workshop by Dr. C. Titus Brown from UC Davis and a wealth of superstar instructors. This week is intended for advanced bioinformatics users and alum of … Continue reading
Length of a String
[17:05] cohenl06@phoenix2 ~ $ a=TGCGGTTATCCATCTGCTTATGGAAGCCAAGCATTGGGGATTGAGAAAGAGTAGAAATGCCACAAGCCTCAATAGCAGGTTTAAGAGCCTCGATACGCTCAAAGTCAAAATAATCAGCGTGACATTCAGAAGGGTAATAAGAACGAACCAA [17:05] cohenl06@phoenix2 ~ $ echo ${#a} 151
Posted in bash, Linux
Leave a comment
Lisa K. Johnson 