Monthly Archives: March 2015

Length of a String

[17:05] cohenl06@phoenix2 ~ $ a=TGCGGTTATCCATCTGCTTATGGAAGCCAAGCATTGGGGATTGAGAAAGAGTAGAAATGCCACAAGCCTCAATAGCAGGTTTAAGAGCCTCGATACGCTCAAAGTCAAAATAATCAGCGTGACATTCAGAAGGGTAATAAGAACGAACCAA [17:05] cohenl06@phoenix2 ~ $ echo ${#a} 151

Posted in bash, Linux | Leave a comment

aRgh

Getting data into the right format is a frustration I have with R: > arrayQualityMetrics(expressionset = eset,outdir = “ArrayQualityMetrics”,intgroup = c(“sample_type_2.0”),do.logtransform=TRUE) The directory ‘ArrayQualityMetrics’ has been created. Error in `[.data.frame`(x, order(x, na.last = na.last, decreasing = decreasing)) : undefined columns … Continue reading

Posted in limma, Microarray, R | Leave a comment

Draft Genome Annotation

Annotating a draft de novo genome assembly of a previously-uncharacterized species with gene function information is a challenging problem. Having the genome sequence is not biologically-important until you know what the sequence does, in terms of what proteins are expressed/translated. … Continue reading

Posted in Bioinformatics | Leave a comment

Useful Linux commands

Decompress a gzipped tar file: tar -xzvf file.tar.gz Or just a tar file: tar -xvf file.tar Install program: tar -xzvf rsem-1.2.8.tar.gz cd rsem-1.2.8 make cd EBSeq make echo ‘export PATH=$PATH:/root/rsem-1.2.8’ >> ~/.bashrc source ~/.bashrc Screen command, when you want to … Continue reading

Posted in bash, Linux | Leave a comment