Monthly Archives: November 2013

Finding coding sequences in DNA

From the UCSD “Bioinformatics Algorithms” class, programming assignments week 2. Given a DNA sequence and an amino acid peptide sequence: DNA=”ATGGCCATGGCCCCCAGAACTGAGATCAATAGTACCCGTATTAACGGGTGA” aapeptide=”MA” I want to find all occurrences (including reverse compliment) of the coding sequence in the DNA for that … Continue reading

Posted in Python | Leave a comment

monsteR Photo Of The Day

Crab-like spiny orb weaver spider, Gasteracantha cancriformis

Posted in Photography | Leave a comment

WHOI Software Carpentry notes, Day 2 – afternoon

Theory: Typical programmer, regardless of language, will write the same number of lines of code in their lifetime compared to any other programmer. Tab completion in the command line rocks. Worth the whole trip. Calculate GC content. seq=’ACGTACGTAGCTAGTAGCTACGTAGCTACGTA’ g=seq.count(‘G’) c=seq.count(‘C’) … Continue reading

Posted in Python, software, Software Carpentry | Leave a comment

WHOI Software Carpentry notes, Day 2 – morning

https://etherpad.mozilla.org/swc-whoi-2013 Distributed version control systems, e.g. git, bzr, hg, dcvs No master controller. All copies are equivalently complete and functional. Yesterday, we ran: git clone http://github.com/wltrimbl/2013-11-14-woodshole Changes were made last night. Today, we need to update. In terminal, we type: … Continue reading

Posted in github, software, Software Carpentry, Ubuntu | Leave a comment

WHOI Software Carpentry notes, Day 1 – afternoon

Python Canopy? sudo apt-get install ipython flcellogrl@flcellogrl:~/2013-11-14-woodshole$ sudo apt-get install ipython [sudo] password for flcellogrl: Reading package lists… Done Building dependency tree Reading state information… Done The following packages were automatically installed and are no longer required: libcurl3-nss libnspr4-dev libnss3-dev … Continue reading

Posted in Python, software, Software Carpentry | Leave a comment